Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a promoterless cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

Article Snippet: For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: DNA Methylation Assay, Activity Assay, Amplification, Clone Assay, Plasmid Preparation, Methylation, Construct, In Vitro, Transfection, Expressing